Login
REGISTER
What Users Get:
Complete Your Profile
Change Password
Request a Password Reset
Home > Tenders > Fvl Forward Primer Tgcccagtgcttaacaagacca Sigma Merck (Quantity Required: 2...
Tender for Fvl Forward Primer Tgcccagtgcttaacaagacca Sigma Merck (Quantity Required: 2 Pieces) from Maharashtra. The reference number of the tender is: 96493149 and the same is closing on 19th Feb 2024. Users can register on the site to get similar tenders.
Procurement Summary
Country : India
State : Maharashtra
Summary : Fvl Forward Primer Tgcccagtgcttaacaagacca Sigma Merck (Quantity Required: 2 Pieces)
Deadline : 19 Feb 2024
Purchaser's Detail
Other Information
Notice Type : Tender
RefID : 96493149
Notice Ref. No. : GEM/2024/B/4594355
Tender Value : Refer Document
Tender EMD : Refer Document
Tender Document Cost : Refer Document
Competition : NCB
Financier : Self Financed
Purchaser Ownership : Public
Tender's Details
Item Description: FVL FORWARD PRIMER TGCCCAGTGCTTAACAAGACCA SIGMA MERCK
BOQ Title: CONSUMABALE
Item Title: Fvl Forward Primer Tgcccagtgcttaacaagacca Sigma Merck
Item Quantity: 2
Unit of Measure: Pieces
Delivery Period (In number of days): 30
Start Date: 07-02-2024 11:58 AM
End Date: 19-02-2024 10:00 AM
Get Local Agent Support for this Tenders.
ContactUsState Basic
Unlimited Website Access
Customised Daily Email Alert
Contract Award Information
Data in Excel (Tenders + Contract Awards)
Access to Archive Tenders
Dedicated Key Account Manager
Subsidised GeM Registration
eTendering Support Services
Number of States [1]
Number of Accounts [1]
Validity, Months [6]
Prices, Rs.1,000 (18% GST Extra)
State Premium
Unlimited Website Access
Customised Daily Email Alert
Contract Award Information
Data in Excel (Tenders + Contract Awards)
Access to Archive Tenders
Dedicated Key Account Manager
Subsidised GeM Registration
eTendering Support Services
Number of States [1]
Number of Accounts [1]
Validity, Months [12]
Prices, Rs.3,000 (18% GST Extra)
India Basic
Unlimited Website Access
Customised Daily Email Alert
Contract Award Information
Data in Excel (Tenders + Contract Awards)
Access to Archive Tenders
Dedicated Key Account Manager
Subsidised GeM Registration
eTendering Support Services
Number of States All India
Number of Accounts [3]
Validity, Months [12]
Prices, Rs.7,500 (18% GST Extra)
India Premium
Unlimited Website Access
Customised Daily Email Alert
Contract Award Information
Data in Excel (Tenders + Contract Awards)
Access to Archive Tenders
Dedicated Key Account Manager
Subsidised GeM Registration
eTendering Support Services
Number of States All India
Number of Accounts [5]
Validity, Months [12]
Prices, Rs.12,000 (18% GST Extra)
Browse Tenders from below Sections